13q14.1-q14.2

An Ideogram is a diagrammatic representation of the karyotype of an organism, or in this case a chromosome.

The RB1 gene is located on the large arm (q) of the 13th chromosome. The 13th chromosome is the 10th smallest out of human's 23 chromosomes.

The RB1 gene transcripts is encoded in 27 exons covering about 200kb of genomic DNA. Individual exons range from 31 to 1,889bp in length. In retinoblastoma deletions are commonly observed in exons 13-17 (Mode of Inheritance).Transcription of RB is initiated at multiple positions (Protein) producing a 4.7 kb mRNA and a 2.7 kb open reading frame.

Finding the Gene

The underlying theory that directed research is known as Knudson's two-hit hypothesis.

The RB1 gene has been found to be closely linked to the ESD (esterase D) locus. The ESD was found intact in sporadic retinoblastoma patients. Two hundred hereditary (75% bilateral and 25%familial) retinoblastoma patients were surveyed to look for evidence of esterase D locus deletion. Half-normal levels of esterase D were found. In a mother and son diagnosed with retinoblastoma due to a deletion of 13q14, esterase D activity in RBC’s was studied. Mother and son had about 50% the normal ESD activity. The son had the tumor formation but the mother did not. This was the first instance of direct transmission of the deletion and the first time a known deletion did not predispose tumor formation. The murine homolog of RB1 was mapped to mouse chromosome 14 by somatic cell hybrids . Recombinant inbred strains suggested close links between Rb1 and Es10, the murine homolog of ESD. A cDNA probe was also found to best hybridize to 13q14.2 and 13q14.3.

Inversion gel electrophoresis (FIGE) was used to construct a restriction map of approximately 1,000 kb of DNA surrounding the RB1 locus to detect the translocation breakpoints. The large size of the presumed RB1 gene, approximately 200 kb, and its multiple dispersed exons, complicate molecular screening for prenatal and presymptomatic diagnosis and for carrier detection.

Today if we wanted to find the RB1 gene, these two primer sequences could be used.

• 5' region of RB1
• GAACTGTGCCATCCCTGTTT
• TTTCTTGTGGGCAAATGTCA
• in the middle of RB1 gene
•  TGTCAGCTCCTGGAAGGATT
• GGAGATGCCAAGGCAAACTA

Finding the protein

Chromosome 13 DNA fragments were cloned identifying RFLP’s from region 13q12-13q22 (the retinoblastoma locus). Using these RFLP’s, homozygosity was found at every chromosome 13 locus tested in three patients without retinoblastoma.

A 1.5 kb DNA sequence that could detect deletions involving 13q14, was used in chromosome walking techniques to isolate and map 30 kb of surrounding genomic DNA. One of these fragments recognized a DNA sequence in a mouse and human chromosome. This conservation suggested that the cloned fragment contained a coding exon of a gene.

This fragment was tested to determine if it could hybridize to RNA derived from retinoblastoma cells and from human retinal cells. Hybridization was found to a 4.7 kb RNA transcript in the retinal cells. Hybridization was not found in retinoblastoma cells. cDNA was also used to analyze the genomic structure of it homologous locus in 50 retinoblastomas. Somatically altered genomic loci were found in 30%. These alterations were in fragments of altered mobility (suggesting gene rearrangements), underrepresented fragments (suggesting heterozygous deletions), and missing fragments (suggesting homozygous deletions). The complete RB1 gene was reported in 1993 by Toguchida(3).